Author Guidelines
Overview of the publication and peer review processes
Zagazig Veterinary Journal (ZVJ) aims to provide all authors with an efficient and consistent editorial process. Submitted manuscripts will be assigned to a member of the editorial team who is an expert in the field. The editor will assess the manuscript to determine whether it is within the scope of the journal, the quality of the data presented, and the novelty of the work before sending it for peer review.
Manuscript will be sent to two reviewers who will be asked to assess whether the manuscript is technically and scientifically sound, coherent and with acceptable writing quality. The final editorial decision will be based on the recommendations of the peer reviewers, provided these recommendations are in accord without any strong dissenting opinions. Where there are dissenting or opposing views, the paper is assessed by a third reviewer who may or may not be a member of the journal's Editorial Board. Once all reviews have been received and considered by the editors, a final decision will be sent to the corresponding author. Possible final decisions include:
- ACCEPT AS SUBMITTED (with routine editing)
- ACCEPT WITH MINOR REVISIONS
- ACCEPT WITH MAJOR REVISION
- REJECT
Copyright
Any manuscript submitted to the journal must not be under consideration by any other journal or already published in any journal or other citable form. Submission of a manuscript to ZVJ implies that all authors have read and agreed to its content and responsible for the reported findings. Authors must complete and sign the Copyright Release Form during manuscript submission.
Ethics of experimentation
The Journal will only accept manuscripts in which there is evidence of the ethical use of animals or harmful substances. The care and use of experimental animals must comply with all relevant local animal welfare laws, guidelines and policies, and a statement of such compliance should be provided upon submission. Editors reserve the right to reject papers if there is doubt as to whether appropriate procedures have been used.
Authorship
All the authors in a manuscript are responsible for the technical information communicated. For this reason it is necessary that all authors must read and approve the final version of the manuscript before signing the consent and declaration form. All named authors must have made an active contribution to the conception and design and/or analysis and interpretation of the data and/or the drafting of the paper and All must have critically reviewed its content and have approved the final version submitted for publication. Participation solely in the acquisition of funding or the collection of data does not justify authorship.
Zagazig Veterinary Journal adheres to the definition of authorship set up by The International Committee of Medical Journal Editors (ICMJE). According to the ICMJE authorship criteria should be based on 1) substantial contributions to conception and design of, or acquisition of data or analysis and interpretation of data, 2) drafting the article or revising it critically for important intellectual content and 3) final approval of the version to be published. Authors should meet conditions 1, 2 and 3.
It is a requirement that all authors have been accredited as appropriate upon submission of the manuscript. Contributors who do not qualify as authors should be mentioned under Acknowledgements.
Change in authorship: We do not allow any change in authorship after provisional acceptance. We cannot allow any addition, deletion or change in sequence of author name.
Similarity index
We check the similarity index with the use of plagiarism detection software (Turnitin). To reduce the similarity, please give proper citations and use the words and sentences carefully. Similarity index should not exceed 20%, otherwise, the manuscript will be rejected before the reviewing process.
Organization of the Manuscript
Articles should be typed double spaced using twelve point Times New Roman.
Original Articles: These should not be less than 3500 words and should not exceed 6000 words (including references, tables, figure legends) and should be organized in the following sections: Title page, Abstract, Introduction, Materials and methods, Results, Discussion (or Results and Discussion), Conflict of Interest, Acknowledgments, References, Figures Legends, Figure (in a separate file) and Tables.
Reviews: These are summaries of developments in areas related to veterinary science which are of broad interest to the target audience of the journal. These are usually invited, but authors identifying a need and wishing to submit a review article are welcome to contact the Editorial Office. Authors are advised to contact the Editorial Office before commencement of writing to ensure that a similar topic has not already been commissioned to another Author. The review article should not exceed 9000 words including references.
Short communication: Should not exceed 2000 words including references, with no more than two tables, two figures and 10 references
Case studies: Should not exceed 1,000 words with no more than 10 references and one table or figure.
Layout of Manuscripts
Title Page:
The title page should include the title of the manuscript as well as the full names and institutional affiliations for all authors. The corresponding author should also be indicated (provide address and email).
Title: The title should contain no more than 150 characters (including spaces) and should be specific to the study. It should be comprehensible to a broad spectrum of readers.
Authors and Affiliations: This section should include the first names, middle initials (if used), surnames, and affiliations (university or organization), department, city, state/province (if applicable), and country for all authors. The institution/laboratory where the work was conducted should be indicated. One of the authors should be designated as the corresponding author. Full contact details including postal address, telephone and fax numbers, and email address for the corresponding author must be provided.
Key words: The authors must provide 4 - 6 keywords.
Abstract
The abstract must not exceed 300 words. Citations, tables and abbreviations should be avoided. The techniques used must be mentioned without going into methodological detail and the most important findings should be summarized.
Introduction
The introduction should be concise and be written in a way understandable to researchers without specialist/expert knowledge in the area. Relevant controversies or disagreements in the field should be mentioned. The introduction should conclude with a comment about the overall aims of the study.
Materials and Methods
This section should include the study design, setting, materials involved, as well as a description of all interventions and comparisons. The authors should also provide a description of the type of statistical analysis used, including a power calculation when appropriate. Well-established methodologies should simply be mentioned and referenced appropriately. For new methods, the protocols for the method should be included. Generic drug names should generally be used and in cases where proprietary brands have been used, the brand names must be included in parenthesis. Where available, the accession numbers of any nucleic acid sequences and protein sequences cited in the manuscript and the corresponding database name should be provided. When referencing a manufacturer with reagents or equipment used, the city and country where the manufacturer is located should also be provided.
Results
The results section should be written in past tense and should provide details of findings that are required to support the manuscript's conclusions. To enhance clarity, the section may be divided into subsections, each with a concise subheading. Where appropriate, results of statistical analysis should include analysis of relative/absolute risks and confidence analysis. Large datasets, including raw data, may be submitted as supporting files for publication as supplementary appendices. The author should refer to the Table/Figure number after the relevant description in the results section.
Discussion
The discussion should clearly identify the main conclusions of the study. Authors should provide a clear explanation of the importance and relevance findings. Speculations on how the conclusions fit in or affect the existing assumptions or models should be explored. Suggestions for further key experiments for future work can be included. When appropriate, issues related to resource limitations faced by the researchers during the course of the study, how these were addressed, and suggestions for improvement may also be included.
Conflict of interest
ZVJ requires that all authors disclose any potential sources of conflict of interest. Any interest or relationship, financial or otherwise, that might be perceived as influencing an author's objectivity is considered a potential source of conflict of interest. If the authors have no conflict of interest to declare, the authors must state “None of the authors have any conflict of interest to declare..”
Acknowledgments
Those who have made substantial contribution to the study in terms of design, execution, analysis or manuscript drafting/revision but do not fit the criteria for authorship should be mentioned in this section. It is the responsibility of the authors to ensure that those being acknowledged have agreed to being named in such capacity. The source of funding for the study should be stated in this section.
References
ZVJ uses the numbered citation method. The references must be listed and numbered consecutively in the order in which they appear in the text. Citations should be indicated by their unique reference number in square brackets in the text. Where there are multiple citations within a single set of brackets these should be separated by commas without spaces. If there are three or more sequential citations, the numbers should be given as a range. Example: "……. [1,6-8,26]."
Reference format examples:
Papers Published in journals
Hanson, B.M.; Dressler, A.E.; Harper, A.L.; Scheibel, R.P.; Wardyn, S.E.; Roberts, L.K.; Kroeger, J.S. and Smith, T.C. (2011): Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J Infect Public Health, 4: 169-174.
Papers In Press
Kharitonov, S.A. and Barnes, P.J. Clinical aspects of exhaled nitric oxide. Adv Clin Path. In press.
Books
Whole Book
Lucas, A.O. and Gilles, H.M. (2003): Short textbook of public health medicine for the tropics, 4th edition. London: Arnold Press 389 p.
Book Chapter
Fernández, E. and Torres, A.C. (2006): Gender differentials in health. In Jamison, D.T.; Bremen, J.G.; Measham, A.R.; Alleyne, G.; Cleason, M.; Evans, D.B.; Jha, P.; Mills, A. and Musgrove, P. editors. Disease Control Priorities in Developing Countries. New York: Oxford University Press. 195-210.
Personal communication and unpublished data should be avoided.
Abbreviations, Symbols and Nomenclature
All specifications must be stated according to the S.I. system. Concentrations of chemical solutions are to be given in mol/l. All other concentrations should be given in % (volume or weight). Any abbreviations of chemical, biological, medical or other terms should only be employed when it is certain that they are internationally known. The full name must be stated in brackets when the abbreviation is first used.
All biological, medical, chemical or other terms should be used according to the most recent recommendations of the respective international nomenclature. Enzymes should be given in I.U. (International Units), according to Enzyme Nomenclature (Elsevier Publishing Co., 1965). In the case of commercially obtained substances or reagents, when they are first mentioned in the text, the name and address of the manufacturer or supplier should be given as a footnote. Products (preparations etc.) with a registered trademark should be marked with.
Bacterial names should be in accordance with the latest edition of Bergey's Manual of Determinative Bacteriology (The Williams and Wilkins Co., Baltimore). Viruses are to be given the classification and names recommended by the International Committee on the Nomenclature of Viruses.
Names of micro-organisms and zoological names should be in italics in the manuscript.
Tables
Submit each table with its title, after References section. Use Arabic numerals to number tables. Details of experimental conditions should be included in the table footnotes. Manuscripts must contain no more than five figures and tables in total. Tables must be prepared using the same word processing package as the manuscript text. Tables must not include ruled vertical or horizontal lines with the exception of headers and footers.
Example for Tables
Table 1:
Primer sequences and expected product sizes of the multiplex PCR
Gene | Primer sequence (5'à3') | Expected product size (bp) |
inlA1 | inlA-Forward | ACGAGTAACGGGACAAATGC | 800 bp |
inlA-Reverse | CCCGACAGTGGTGCTAGATT |
inlC2 | inlC-Forward | AATTCCCACAGGACACAACC | 517 bp |
inlC-Reverse | CGGGAATGCAATTTTTCACTA |
inlJ3 | inlJ-Forward | TGTAACCCCGCTTACACAGTT | 238 bp |
inlJ-Reverse | AGCGGCTTGGCAGTCTAATA |
1The inlA primers were intended for species-specific recognition, and the 2 inlC and 3 inlJ primers were designed for virulence determination of L. monocytogenes.
Figures
Figure legends should follow Tables and the Figures should be in a separate electronic file (tif or jpg). They should be numbered consecutively using Arabic numerals (Figure1, Figure 2, Figure 3).
Fees
For Egyptians
For publication in Zag. Vet J., 300 Egyptian Pounds should be paid on the day of manuscript submission for reviewing, plagiarism and proof reading charges.
Page charges for this journal are set at 25 Egyptian Pounds per typeset page. Nonpayment of page charges may result in a delay in publication.
*For non-Egyptians
Publication in Zagazig Veterinary Journal costs 100 US Dollars (one hundred US Dollars).
Reprints
Hard copies (current or archived) issues can be delivered upon request with the appropriate cost according to the number of pages, copies and transportation.
Additional reprints for authors can also be delivered.
After acceptance of the manuscript
English language editing: Final English language editing will be done by experts after receipt of article processing charge.
Proof Corrections: The corresponding author will receive an e-mail containing PDF. A working e-mail address must therefore be provided for the corresponding author. The proof can be downloaded as a PDF (portable document format).
Proofs must be returned to the Editor within two days of receipt with corrections if any. If there is no correction then corresponding author must have to reply accordingly. We ask that you only correct typesetting errors and grammatical errors if any. Please note that the author is responsible for all statements made in their work, including changes made.
Online publication and reprints: Author can download the PDF from the site. Reprints (hard copy) can be sent by post on request by the author, or, they can be collected from the Editorial office. Six hard copies of the manuscript are prepared and their charge are included within the publication fees. Online articles are complete and final. They have been fully reviewed, revised and edited for publication, and the authors' final corrections have been incorporated. We do assign DOI to each newly published article.
* To Download a complete Authors Guidelines file, please click Here
